PTXBC014501
New product
This product is no longer in stock
Availability date:
Brand | ProteoGenix |
Product type | DNA & cDNA |
Origin species | Human |
Brand: | ProteoGenix |
Proteogenix catalog: | PTXBC014501 |
Product type: | DNA & cDNA |
Ncbi symbol: | FHL3 |
Origin species: | Human |
Product name: | FHL3-four and a half LIM domains 3 Gene |
Size: | 2ug |
Accessions: | BC014501 |
Gene id: | 2275 |
Gene description: | four and a half LIM domains 3 |
Synonyms: | LIM-only protein FHL3; SLIM2; four and a half LIM domains protein 3; FHL-3; SLIM-2; skeletal muscle LIM-protein 2; four and a half LIM domains 3 |
Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
Orf sequence: | atgcctgggtcccggaagctggaatatggaggccagacatggcatgagcactgcttcctgtgcagtggctgtgaacagccactgggctcccgttcttttgtgcccgacaagggtgctcactactgcgtgccctgctatgagaacaagtttgctcctcgctgcgcccgctgcagcaagacgctgacacagggtggagtgacataccgtgatcagccatggcatcgagaatgtctggtctgtaccggatgccagacgcccctggcagggcagcagttcacctcccgggatgaagatccctactgtgtggcctgttttggagaactctttgcacctaagtgcagcagctgcaagcgccccatcgtaggactcggtggaggcaagtatgtgtcctttgaagaccgacactggcaccacaactgcttctcctgcgcccgctgctctacctccctggtgggccagggcttcgtaccggatggagaccaagtgctctgccagggctgtagccaggcagggccctaa |
Vector: | pDONR223 |
Delivery lead time in business days in europe: | 10-12 days |
Storage: | -20â |
Delivery condition: | Blue Ice |
Related products: | - hypothetical FLJ23584 - growth associated protein 43 - canopy 3 homolog (zebrafish) - Yip1 domain family, member 2 |