Cart 36 Product Products 5 069,98 € (empty)
-
-
1 x TGFB1-tran...121,50 € -
-
1 x TRAF4...259,07 € -
-
1 x MRPL36-mit...113,40 € -
-
1 x COX7A2L-cy...113,40 € -
1 x FAM83F-fam...121,50 € -
1 x PTDSS2-pho...121,50 € -
1 x STH-saitoh...113,40 € -
1 x OMG-oligod...121,50 € -
1 x Ret...259,07 € -
1 x C2orf53-ch...121,50 € -
1 x CD320-CD32...121,50 € -
-
1 x C15orf23-c...121,50 € -
1 x ATP1B1-ATP...121,50 € -
1 x JMJD7-jumo...121,50 € -
1 x LHR...259,07 € -
-
-
-
1 x FAM122B-fa...113,40 € -
1 x RUVBL2-Ruv...113,40 € -
1 x C6orf123-c...113,40 € -
1 x C19orf39-c...113,40 € -
1 x CAPZB-capp...121,50 € -
-
1 x TMEM126B-t...113,40 € -
1 x TULP1-tubb...121,50 € -
1 x NCALD-neur...113,40 € -
1 x TANK-TRAF...121,50 € -
-
1 x CCDC50-coi...121,50 € -
No products
To be determined Shipping
5 069,98 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 36 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 5 069,98 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 5 069,98 €
Data sheet of HMP19-HMP19 protein Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about HMP19-HMP19 protein Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC002619 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | HMP19 |
| Origin species: | Human |
| Product name: | HMP19-HMP19 protein Gene |
| Size: | 2ug |
| Accessions: | BC002619 |
| Gene id: | 51617 |
| Gene description: | HMP19 protein |
| Synonyms: | HMP19 protein; neuron-specific protein family member 2; NSG2; hypothalamus golgi apparatus expressed 19 kDa protein; p19 protein; protein p19 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggtgaagctgaacagtaaccccagcgagaagggaaccaagccgccttcagttgaggatggcttccagaccgtccctctcatcactcccttggaggttaatcacttacagctgcctgctccagaaaaggtgattgtgaagacaagaacggaatatcagccggaacagaagaacaaagggaagttccgggtgccgaaaatcgctgaatttacggtcaccatccttgtcagcctggccctagctttccttgcgtgcatcgtgttcctggtggtttacaaagccttcacctatgatcacagctgcccagagggattcgtctataagcacaaacgctgtatcccagcctccctggatgcttactactcctcccaggaccccaattccagaagccgcttctacacagtcatcagccactacagcgtggccaagcagagcactgcccgggccatcgggccgtggctgtcagcagccgctgtcatccatgagcccaagccgcccaagacccagggccactag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - transgelin 2 - homeobox B13 - formin-like 2 - interleukin 11 |