Cart 30 Product Products 3 429,19 € (empty)
-
1 x ECHS1-enoy...121,50 € -
1 x TAF5L-TAF5...121,50 € -
1 x SPAG7-sper...113,40 € -
-
1 x LMBR1L-lim...121,50 € -
1 x FDX1L-ferr...113,40 € -
-
-
1 x FAM124B-fa...121,50 € -
1 x PITX1-pair...121,50 € -
1 x ACTL6A-act...121,50 € -
1 x CD200-CD20...121,50 € -
1 x IGFBP5-ins...121,50 € -
1 x FAM27L-fam...113,40 € -
1 x CACNG3-cal...121,50 € -
1 x MIOX-myo-i...121,50 € -
1 x MRPL45-mit...121,50 € -
1 x F7-coagula...121,50 € -
-
1 x NDUFV3-NAD...113,40 € -
1 x EDNRA-endo...121,50 € -
1 x FLI1-Frien...121,50 € -
1 x SCAMP1-sec...113,40 € -
1 x LOC1001255...113,40 € -
-
-
-
-
1 x C3orf45-ch...113,40 € -
1 x ATP6V0C-AT...113,40 €
No products
To be determined Shipping
3 429,19 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 30 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 3 429,19 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 3 429,19 €
Data sheet of MRPS24-mitochondrial ribosomal protein S24 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about MRPS24-mitochondrial ribosomal protein S24 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC012167 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | MRPS24 |
| Origin species: | Human |
| Product name: | MRPS24-mitochondrial ribosomal protein S24 Gene |
| Size: | 2ug |
| Accessions: | BC012167 |
| Gene id: | 64951 |
| Gene description: | mitochondrial ribosomal protein S24 |
| Synonyms: | HSPC335; MRP-S24; S24mt; bMRP-47; bMRP47; 28S ribosomal protein S24, mitochondrial; mitochondrial 28S ribosomal protein S24; mitochondrial ribosomal protein S24 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcggcctccgtgtgcagcgggttgctggggccacgggtgctgtcctggagccgagagctgccttgcgcttggcgcgccctgcacacctccccggtctgcgccaagaaccgggcggcccgagtacgcgtaagcaagggggacaagccggtgacctacgaggaggcacacgcgccgcactacatcgcccaccgtaaaggctggctgtcgctgcacacaggtaacctggatggagaggaccatgccgcagagcgaacggtggaggatgttttccttcgcaagttcatgtggggtaccttcccaggctgcctggctgaccagctggttttaaagcgccggggtaaccagttggagatctgtgccgtggtcctgaggcagttgtctccacacaagtactacttcctcgtgggctacagtgaaactttgctgtcctacttttacaaatgtcctgtgcgactccacctccaaactgtgccctcaaaggttgtgtataagtacctctag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - zinc finger CCCH-type containing 7A - chromosome 2 open reading frame 28 - golgi SNAP receptor complex member 1 - chromosome 7 open reading frame 33 |