Cart 3 Product Products 339,81 € (empty)
-
1 x ISG20L2-in...121,50 € -
-
No products
To be determined Shipping
339,81 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 3 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 339,81 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 339,81 €
Data sheet of CFL2-cofilin 2 (muscle) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about CFL2-cofilin 2 (muscle) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC011444 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | CFL2 |
| Origin species: | Human |
| Product name: | CFL2-cofilin 2 (muscle) Gene |
| Size: | 2ug |
| Accessions: | BC011444 |
| Gene id: | 1073 |
| Gene description: | cofilin 2 (muscle) |
| Synonyms: | NEM7; cofilin-2; cofilin 2 (muscle); cofilin, muscle isoform; nemaline myopathy type 7; cofilin 2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcttctggagttacagtgaatgatgaagtcatcaaagtttttaatgatatgaaagtaaggaaatcttctacacaagaggagatcaaaaagagaaagaaagcagttctcttctgtttaagcgatgacaaaagacaaataattgtagaggaagcaaagcagatcttggtgggtgacattggtgatactgtagaggacccctacacatcttttgtgaagttgctacctctgaatgattgccgatatgctttgtacgatgccacatacgaaacaaaagagtctaagaaagaagacctagtatttatattctgggctcctgaaagtgcacctttaaaaagcaagatgatttatgctagctctaaagatgccattaaaaagaaatttacaggtattaaacatgagtggcaagtaaatggcttggatgatattaaggaccgttcgacacttggagagaaattgggaggcaatgtagtagtttcacttgaaggaaaaccattataa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - cytochrome b-561 - spermidine synthase - WD repeat domain 1 - nucleoporin 85kDa |