Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of NKG7-natural killer cell group 7 sequence Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about NKG7-natural killer cell group 7 sequence Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC015759 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | NKG7 |
| Origin species: | Human |
| Product name: | NKG7-natural killer cell group 7 sequence Gene |
| Size: | 2ug |
| Accessions: | BC015759 |
| Gene id: | 4818 |
| Gene description: | natural killer cell group 7 sequence |
| Synonyms: | protein NKG7; GIG1; GMP-17; p15-TIA-1; G-CSF-induced gene 1 protein; GIG-1 protein; granule membrane protein 17; granule membrane protein of 17 kDa; natural killer cell group 7 sequence; natural killer cell protein 7; natural killer cell granule protein 7 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggagctctgccggtccctggccctgctggggggctccctgggcctgatgttctgcctgattgctttgagcaccgatttctggtttgaggctgtgggtcccacccactcagctcactcgggcctctggccaacagggcatggggacatcatatcaggctacatccacgtgacgcagaccttcagcattatggctgttctgtgggccctggtgtccgtgagcttcctggtcctgtcctgcttcccctcactgttccccccaggccacggcccgcttgtctcaaccaccgcagcctttgctgcagccatctccatggtggtggccatggcggtgtacaccagcgagcggtgggaccagcctccacacccccagatccagaccttcttctcctggtccttctacctgggctgggtctcagctatcctcttgctctgtacaggtgccctgagcctgggtgctcactgtggcggtccccgtcctggctatgaaaccttgtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - nuclear apoptosis inducing factor 1 - nucleoporin 62kDa C-terminal like - isochorismatase domain containing 2 - phosphatidylcholine transfer protein |