PTXBC011757
New product
This product is no longer in stock
Availability date:
Brand | ProteoGenix |
Product type | DNA & cDNA |
Origin species | Human |
Brand: | ProteoGenix |
Proteogenix catalog: | PTXBC011757 |
Product type: | DNA & cDNA |
Ncbi symbol: | GADD45A |
Origin species: | Human |
Product name: | GADD45A-growth arrest and DNA-damage-inducible, alpha Gene |
Size: | 2ug |
Accessions: | BC011757 |
Gene id: | 1647 |
Gene description: | growth arrest and DNA-damage-inducible, alpha |
Synonyms: | DDIT1; GADD45; growth arrest and DNA damage-inducible protein GADD45 alpha; DDIT-1; DNA damage-inducible transcript 1 protein; DNA damage-inducible transcript-1; growth arrest and DNA-damage-inducible 45 alpha; growth arrest and DNA damage inducible alpha |
Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
Orf sequence: | atgactttggaggaattctcggctggagagcagaagaccgaaaggatggataaggtgggggatgccctggaggaagtgctcagcaaagccctgagtcagcgcacgatcactgtcggggtgtacgaagcggccaagctgctcaacgtcgaccccgataacgtggtgttgtgcctgctggcggcggacgaggacgacgacagagatgtggctctgcagatccacttcaccctgatccaggcgttttgctgcgagaacgacatcaacatcctgcgcgtcagcaacccgggccggctggcggagctcctgctcttggagaccgacgctggccccgcggcgagcgagggcgccgagcagcccccggacctgcactgcgtgctggtgacgaatccacattcatctcaatggaaggatcctgccttaagtcaacttatttgtttttgccgggaaagtcgctacatggatcaatgggttccagtgattaatctccctgaacggtga |
Vector: | pDONR223 |
Delivery lead time in business days in europe: | 10-12 days |
Storage: | -20â |
Delivery condition: | Blue Ice |
Related products: | - myosin, light chain 2, regulatory, cardiac, slow - family with sequence similarity 163, member A - BCL2/adenovirus E1B 19kDa interacting protein 3 - N-acetyltransferase 14 (GCN5-related, putative) |