SKP1-S-phase kinase-associated protein 1 Gene

View larger

SKP1-S-phase kinase-associated protein 1 Gene

Reference: PTXBC009839

Condition: New product

Print

Data sheet of SKP1-S-phase kinase-associated protein 1 Gene

Brand	ProteoGenix
Product type	DNA & cDNA
Origin species	Human

More info about SKP1-S-phase kinase-associated protein 1 Gene

Brand:	ProteoGenix
Proteogenix catalog:	PTXBC009839
Product type:	DNA & cDNA
Ncbi symbol:	SKP1
Origin species:	Human
Product name:	SKP1-S-phase kinase-associated protein 1 Gene
Size:	2ug
Accessions:	BC009839
Gene id:	6500
Gene description:	S-phase kinase-associated protein 1
Synonyms:	EMC19; OCP-II; OCP2; SKP1A; TCEB1L; p19A; S-phase kinase-associated protein 1; OCP-2; RNA polymerase II elongation factor-like protein OCP2; SIII; cyclin A/CDK2-associated p19; cyclin-A/CDK2-associated protein p19; organ of Corti protein 2; organ of Corti protein II; p19skp1; transcription elongation factor B polypeptide 1-like; S-phase kinase associated protein 1
Sequence primers:	Forward primer M13R (5'â†’3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â†’3'): TAATACGACTCACTATAGG
Orf sequence:	atgccttcaattaagttgcagagttctgatggagagatatttgaagttgatgtggaaattgccaaacaatctgtgactattaagaccatgttggaagatttgggaatggatgatgaaggagatgatgacccagttcctctaccaaatgtgaatgcagcaatattaaaaaaggtcattcagtggtgcacccaccacaaggatgaccctcctcctcctgaagatgatgagaacaaagaaaagcgaacagatgatatccctgtttgggaccaagaattcctgaaagttgaccaaggaacactttttgaactcattctggctgcaaactacttagacatcaaaggtttgcttgatgttacatgcaagactgttgccaatatgatcaaggggaaaactcctgaggagattcgcaagaccttcaatatcaaaaatgactttactgaagaggaggaagcccaggtacgcaaagagaaccagtggtgtgaagagaagtga
Vector:	pDONR223
Delivery lead time in business days in europe:	10-12 days
Storage:	-20â„ƒ
Delivery condition:	Blue Ice
Related products:	- suppressor of cytokine signaling 2 - sphingosine-1-phosphate receptor 1 - nitric oxide synthase trafficker - mitochondrial ribosomal protein S5

Reviews

Be the first to write your review !

Buy SKP1-S-phase kinase-associated protein 1 Gene now