Cart 3 Product Products 328,22 € (empty)
-
-
-
1 x CRK-v-crk...113,40 €
No products
To be determined Shipping
328,22 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 3 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 328,22 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 328,22 €
Data sheet of RPS11-ribosomal protein S11 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about RPS11-ribosomal protein S11 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC007283 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | RPS11 |
| Origin species: | Human |
| Product name: | RPS11-ribosomal protein S11 Gene |
| Size: | 2ug |
| Accessions: | BC007283 |
| Gene id: | 6205 |
| Gene description: | ribosomal protein S11 |
| Synonyms: | S11; 40S ribosomal protein S11; ribosomal protein S11 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcggacattcagactgagcgtgcctaccaaaagcagccgaccatctttcaaaacaagaagagggtcctgctgggagaaactggcaaggagaagctcccgcggtactacaagaacatcggtctgggcttcaagacacccaaggaggctattgagggcacctacattgacaagaaatgccccttcactggtaatgtgtccattcgagggcggatcctctctggcgtggtgaccaagatgaagatgcagaggaccattgtcatccgccgagactatctgcactacatccgcaagtacaaccgcttcgagaagcgccacaagaacatgtctgtacacctgtccccctgcttcagggacgtccagatcggtgacatcgtcacagtgggcgagtgccggcctctgagcaagacagtgcgcttcaacgtgctcaaggtcaccaaggctgccggcaccaagaagcagttccagaagttctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - titin-cap (telethonin) - ribosomal protein L11 - ribosomal protein L17 - histone deacetylase 7 |