Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of AGFG2-ArfGAP with FG repeats 2 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about AGFG2-ArfGAP with FG repeats 2 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC009393 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | AGFG2 |
| Origin species: | Human |
| Product name: | AGFG2-ArfGAP with FG repeats 2 Gene |
| Size: | 2ug |
| Accessions: | BC009393 |
| Gene id: | 3268 |
| Gene description: | ArfGAP with FG repeats 2 |
| Synonyms: | HRBL; RABR; arf-GAP domain and FG repeat-containing protein 2; HIV-1 Rev-binding protein-like protein; Rev/Rex activation domain binding protein-related; arf-GAP domain and FG repeats-containing protein 2; nucleoporin; rev/Rex activation domain-binding protein related; ArfGAP with FG repeats 2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggtgatggcggcgaagaagggcccgggcccgggcggcggggtcagcgggggcaaggcggaggcggaggcggcctcggaggtgtggtgccgtcgggtgcgggagctgggtggctgcagccaggccgggaaccgccactgcttcgagtgcgcccagcgcggggtcacctacgtggatatcaccgtgggcagcttcgtgtgcaccacctgctccggcctcctgagagggctgaacccccctcatcgtgtcaagtcaatctccatgacaactttcactgagcctgaagtagtattcctgcaatcccgtggaaatgaggtttgccggaagatttggttgggtctgtttgatgctcggacatctttagtaccagattccagggatcctcagaaagtgaaggagtttctccaggaaaaatatgagaagaagagatggccagacaccttcccaaggaggctttgccaactttga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - zinc finger protein 576 - ring finger protein 183 - zinc finger protein 684 - APAF1 interacting protein |