PTXBC009393
New product
This product is no longer in stock
Availability date:
Brand | ProteoGenix |
Product type | DNA & cDNA |
Origin species | Human |
Brand: | ProteoGenix |
Proteogenix catalog: | PTXBC009393 |
Product type: | DNA & cDNA |
Ncbi symbol: | AGFG2 |
Origin species: | Human |
Product name: | AGFG2-ArfGAP with FG repeats 2 Gene |
Size: | 2ug |
Accessions: | BC009393 |
Gene id: | 3268 |
Gene description: | ArfGAP with FG repeats 2 |
Synonyms: | HRBL; RABR; arf-GAP domain and FG repeat-containing protein 2; HIV-1 Rev-binding protein-like protein; Rev/Rex activation domain binding protein-related; arf-GAP domain and FG repeats-containing protein 2; nucleoporin; rev/Rex activation domain-binding protein related; ArfGAP with FG repeats 2 |
Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
Orf sequence: | atggtgatggcggcgaagaagggcccgggcccgggcggcggggtcagcgggggcaaggcggaggcggaggcggcctcggaggtgtggtgccgtcgggtgcgggagctgggtggctgcagccaggccgggaaccgccactgcttcgagtgcgcccagcgcggggtcacctacgtggatatcaccgtgggcagcttcgtgtgcaccacctgctccggcctcctgagagggctgaacccccctcatcgtgtcaagtcaatctccatgacaactttcactgagcctgaagtagtattcctgcaatcccgtggaaatgaggtttgccggaagatttggttgggtctgtttgatgctcggacatctttagtaccagattccagggatcctcagaaagtgaaggagtttctccaggaaaaatatgagaagaagagatggccagacaccttcccaaggaggctttgccaactttga |
Vector: | pDONR223 |
Delivery lead time in business days in europe: | 10-12 days |
Storage: | -20℃ |
Delivery condition: | Blue Ice |
Related products: | - zinc finger protein 576 - ring finger protein 183 - zinc finger protein 684 - APAF1 interacting protein |