Cart 5 Product Products 574,42 € (empty)
-
1 x IMPACT-Imp...121,50 € -
-
1 x C4orf12-ch...113,40 € -
-
1 x REXO1L2P-R...121,50 €
No products
To be determined Shipping
574,42 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 5 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 574,42 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 574,42 €
View larger 
MRM1-mitochondrial rRNA methyltransferase 1 homolog (S. cerevisiae) Gene
PTXBC009416
New product
Data sheet of MRM1-mitochondrial rRNA methyltransferase 1 homolog (S. cerevisiae) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about MRM1-mitochondrial rRNA methyltransferase 1 homolog (S. cerevisiae) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC009416 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | MRM1 |
| Origin species: | Human |
| Product name: | MRM1-mitochondrial rRNA methyltransferase 1 homolog (S. cerevisiae) Gene |
| Size: | 2ug |
| Accessions: | BC009416 |
| Gene id: | 79922 |
| Gene description: | mitochondrial rRNA methyltransferase 1 homolog (S. cerevisiae) |
| Synonyms: | rRNA methyltransferase 1, mitochondrial; 16S rRNA (guanosine(1145)-2'-O)-methyltransferase; 16S rRNA [Gm1145] 2'-O-methyltransferase; CTB-75G16.3; mitochondrial large ribosomal RNA ribose methylase; mitochondrial rRNA methyltransferase 1 homolog; mitochondrial rRNA methyltransferase 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggacgtgttctccactgatgacctcaccggatttttacagaccaaagcccagcagggctggctcgtggccggcacggtgggctgcccaagcacagaggatccccagtcctccgagatccccatcatgagttgcttggagttcctctgggaacggcctactctccttgtgctggggaatgagggctcaggtctatcccaggaggtgcaggcctcctgccagcttctcctcaccatcctgccccggcgccagctgcctcctggacttgagtccttgaacgtctctgtggctgcaggaattcttcttcactccatttgcagccagaggaagggtttccccacagagggggagagaaggcagcttctccaagacccccaagaaccctcagccaggtctgaagggctcagcatggctcagcacccagggctgtcttcaggcccagagaaagagaggcaaaatgagggctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - potassium voltage-gated channel, Isk-related family, member 4 - protein kinase, AMP-activated, gamma 1 non-catalytic subunit - protein phosphatase 2, regulatory subunit B', gamma isoform - Cas-Br-M (murine) ecotropic retroviral transforming sequence b |