Cart 41 Product Products 4 745,90 € (empty)
-
1 x CHMP6-chro...113,40 € -
-
1 x KRR1-KRR1,...121,50 € -
1 x PVRL3-poli...121,50 € -
1 x SLC22A24-s...121,50 € -
1 x CTSE-cathe...121,50 € -
-
-
1 x CD34-CD34...121,50 € -
1 x NINJ2-ninj...113,40 € -
1 x MFSD5-majo...121,50 € -
-
-
1 x TWSG1-twis...113,40 € -
1 x PSPC1-para...121,50 € -
1 x FNTA-farne...113,40 € -
1 x FANCA-Fanc...121,50 € -
1 x OSBPL1A-ox...121,50 € -
1 x CHKB-choli...121,50 € -
-
-
1 x TPI1-trios...113,40 € -
-
-
1 x UBE2D4-ubi...113,40 € -
1 x ZCCHC10-zi...113,40 € -
1 x SQRDL-sulf...121,50 € -
1 x ADCYAP1R1-...121,50 € -
-
-
1 x BAAT-bile...121,50 € -
1 x GYG1-glyco...121,50 € -
-
-
1 x KCNAB3-pot...121,50 € -
1 x RPL15-ribo...113,40 € -
-
1 x C18orf18-c...113,40 € -
1 x NAT14-N-ac...113,40 € -
1 x PLA1A-phos...121,50 € -
1 x PSME3-prot...113,40 €
No products
To be determined Shipping
4 745,90 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 41 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 4 745,90 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 4 745,90 €
Data sheet of MAL-mal, T-cell differentiation protein Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about MAL-mal, T-cell differentiation protein Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC000458 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | MAL |
| Origin species: | Human |
| Product name: | MAL-mal, T-cell differentiation protein Gene |
| Size: | 2ug |
| Accessions: | BC000458 |
| Gene id: | 4118 |
| Gene description: | mal, T-cell differentiation protein |
| Synonyms: | mal, T-cell differentiation protein; myelin and lymphocyte protein; MyD88-adapter-like; T-lymphocyte maturation-associated protein |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcccccgcagcggcgacggggggcagcaccctgcccagtggcttctcggtcttcaccaccttgcccgacttgctcttcatctttgagtttatcttcgggggcctggtgtggatcctggtggcctcctccctggtgccctggcccctggtccagggctgggtgatgttcgtgtctgtgttctgcttcgtggccaccaccaccttgatcatcctgtacataattggagcccacggtggagagacttcctgggtcaccttggacgcagcctaccactgcaccgctgccctcttttacctcagcgcctcagtcctggaggccctggccaccatcacgatgcaagacggcttcacctacaggcactaccatgaaaacattgctgccgtggtgttctcctacatagccactctgctctacgtggtccatgcggtgttctctttaatcagatggaagtcttcataa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - cytoskeleton associated protein 2 - GTP-binding protein 8 (putative) - cancer susceptibility candidate 4 - coiled-coil domain containing 53 |