Cart 5 Product Products 587,37 € (empty)
-
1 x SUCLG2-suc...121,50 € -
1 x CUEDC2-CUE...113,40 € -
1 x AVL9-AVL9...121,50 € -
1 x CCDC51-coi...121,50 € -
No products
To be determined Shipping
587,37 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 5 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 587,37 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 587,37 €
View larger 
Data sheet of AGTRAP-angiotensin II receptor-associated protein Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about AGTRAP-angiotensin II receptor-associated protein Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC017328 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | AGTRAP |
| Origin species: | Human |
| Product name: | AGTRAP-angiotensin II receptor-associated protein Gene |
| Size: | 2ug |
| Accessions: | BC017328 |
| Gene id: | 57085 |
| Gene description: | angiotensin II receptor-associated protein |
| Synonyms: | ATRAP; type-1 angiotensin II receptor-associated protein; AT1 receptor-associated protein; ATI receptor-associated protein; angiotensin II, type I receptor-associated protein; angiotensin II receptor associated protein |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggagctgcctgctgtgaacctgaaggtgattctcctaggtcactggctgctgacaacctggggctgcattgtattctcaggctcctatgcctgggccaacttcaccatcctggccttgggcgtgtgggctgtggctcagcgggactccatcgacgccataagcatgtttctgggtggcttgctggccaccatcttcctggacatcgtgcacatcagcatcttctacccgcgggtcagcctcacggacacgggccgctttggcgtgggcatggccatcctcagcttgctgctcaagccgctctcctgctgcttcgtctaccacatgtaccgggagcgcgggggtttccttgggtcttctcaggaccgtagtgcctaccagacgattgactcagcagaggcgcccgcagatccctttgcagtcccagagggcaggagtcaagatgcccgagggtactga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - ubiquitin-conjugating enzyme E2W (putative) - UEV and lactate/malate dehyrogenase domains - sodium channel, voltage-gated, type I, beta - WW domain containing adaptor with coiled-coil |