PTXBC016157
New product
This product is no longer in stock
Availability date:
Brand | ProteoGenix |
Product type | DNA & cDNA |
Origin species | Human |
Brand: | ProteoGenix |
Proteogenix catalog: | PTXBC016157 |
Product type: | DNA & cDNA |
Ncbi symbol: | FAM176A |
Origin species: | Human |
Product name: | FAM176A-family with sequence similarity 176, member A Gene |
Size: | 2ug |
Accessions: | BC016157 |
Gene id: | 84141 |
Gene description: | family with sequence similarity 176, member A |
Synonyms: | protein FAM176A; FAM176A; TMEM166; protein eva-1 homolog A; eva-1 homolog A; family with sequence similarity 176, member A; transmembrane protein 166; eva-1 homolog A, regulator of programmed cell death |
Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
Orf sequence: | atgaggctgcccctcagccacagcccagagcacgtggagatggctttgctcagcaacatcctagcggcctattcctttgtctcagaaaatcctgagcgagcagctctgtactttgtttctggcgtgtgcatcgggctggtgctgaccctggctgctctggtgataaggatctcttgccacacagactgcaggcggcgtcccgggaagaagttcctgcaggacagagagagcagcagcgacagcagcgacagcgaggatggcagtgaggacaccgtgtccgatctctccgtgcggagacaccgccgcttcgagaggactttgaacaagaatgtgttcacctctgcggaggagctggagcgcgcccagcggctggaggagcgcgagcgcatcatcagggagatctggatgaatggccagcctgaggtgcccgggaccaggagcctgaatcgctactattag |
Vector: | pDONR223 |
Delivery lead time in business days in europe: | 10-12 days |
Storage: | -20℃ |
Delivery condition: | Blue Ice |
Related products: | - ubiquitin-conjugating enzyme E2A (RAD6 homolog) - growth arrest and DNA-damage-inducible, alpha - myosin, light chain 2, regulatory, cardiac, slow - family with sequence similarity 163, member A |