WTAP-Wilms tumor 1 associated protein Gene View larger

WTAP-Wilms tumor 1 associated protein Gene

PTXBC000383

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of WTAP-Wilms tumor 1 associated protein Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about WTAP-Wilms tumor 1 associated protein Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC000383
Product type: DNA & cDNA
Ncbi symbol: WTAP
Origin species: Human
Product name: WTAP-Wilms tumor 1 associated protein Gene
Size: 2ug
Accessions: BC000383
Gene id: 9589
Gene description: Wilms tumor 1 associated protein
Synonyms: pre-mRNA-splicing regulator WTAP; Mum2; PNAS-132; WT1-associated protein; Wilms' tumour 1-associating protein; female-lethal(2)D homolog; hFL(2)D; wilms tumor 1-associating protein; Wilms tumor 1 associated protein
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaccaacgaagaacctcttcccaagaaggttcgattgagtgaaacagacttcaaagttatggcaagagatgagttaattctaagatggaaacaatatgaagcatatgtacaagctttggagggcaagtacacagatcttaactctaatgatgtaactggcctaagagagtctgaagaaaaactaaagcaacaacagcaggagtctgcacgcagggaaaacatccttgtaatgcgactagcaaccaaggaacaagagatgcaagagtgtactactcaaatccagtacctcaagcaagtccagcagccgagcgttgcccaactgagatcaacaatggtagacccagcgatcaacttgtttttcctaaaaatgaaaggtgaactggaacagactaaagacaaactggaacaagcccaaaatgaactgagtgcctggaagtttacgcctgataggtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - ubiquitously-expressed transcript
- slingshot homolog 2 (Drosophila)
- ubiquitin specific peptidase 53
- tripartite motif family-like 1

Reviews

Buy WTAP-Wilms tumor 1 associated protein Gene now

Add to cart