Cart 2 Product Products 234,90 € (empty)
-
1 x ANKRD44-an...121,50 € -
1 x MOBP-myeli...113,40 €
No products
To be determined Shipping
234,90 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 2 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 234,90 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 234,90 €
Data sheet of TMEM85-transmembrane protein 85 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about TMEM85-transmembrane protein 85 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC002583 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | TMEM85 |
| Origin species: | Human |
| Product name: | TMEM85-transmembrane protein 85 Gene |
| Size: | 2ug |
| Accessions: | BC002583 |
| Gene id: | 51234 |
| Gene description: | transmembrane protein 85 |
| Synonyms: | TMEM85; PIG17; ER membrane protein complex subunit 4; cell proliferation-inducing gene 17 protein; transmembrane protein 85 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgacggcccaggggggcctggtggctaaccgaggccggcgcttcaagtgggccattgagctaagcgggcctggaggaggcagcaggggtcgaagtgaccggggcagtggccagggagactcgctctacccagtcggttacttggacaagcaagtgcctgataccagcgtgcaagagacagaccggatcctggtggagaagcgctgctgggacatcgccttgggtcccctcaaacagattcccatgaatctcttcatcatgtacatggcaggcaatactatctccatcttccctactatgatggtgtgtatgatggcctggcgacccattcaggcacttatggccatttcagccaagaatggagttcagtggtggaggactgcttttgtgaacatgagaaagcagcgcctggtccctatgtatttgggtcttatttacatccttctttaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - glycine-N-acyltransferase - prohibitin pseudogene - MAX dimerization protein 3 - centrosomal protein 70kDa |