PTP4A3-protein tyrosine phosphatase type IVA, member 3 Gene

View larger

PTP4A3-protein tyrosine phosphatase type IVA, member 3 Gene

Reference: PTXBC003105

Condition: New product

Print

Data sheet of PTP4A3-protein tyrosine phosphatase type IVA, member 3 Gene

Brand	ProteoGenix
Product type	DNA & cDNA
Origin species	Human

More info about PTP4A3-protein tyrosine phosphatase type IVA, member 3 Gene

Brand:	ProteoGenix
Proteogenix catalog:	PTXBC003105
Product type:	DNA & cDNA
Ncbi symbol:	PTP4A3
Origin species:	Human
Product name:	PTP4A3-protein tyrosine phosphatase type IVA, member 3 Gene
Size:	2ug
Accessions:	BC003105
Gene id:	11156
Gene description:	protein tyrosine phosphatase type IVA, member 3
Synonyms:	PRL-3; PRL-R; PRL3; protein tyrosine phosphatase type IVA 3; potentially prenylated protein tyrosine phosphatase; protein-tyrosine phosphatase 4a3; protein-tyrosine phosphatase of regenerating liver 3; protein tyrosine phosphatase type IVA, member 3
Sequence primers:	Forward primer M13R (5'â†’3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â†’3'): TAATACGACTCACTATAGG
Orf sequence:	atggctcggatgaaccgcccggccccggtggaggtgagctacaaacacatgcgcttcctcatcacccacaaccccaccaacgccacgctcagcaccttcattgaggacctgaagaagtacggggctaccactgtggtgcgtgtgtgtgaagtgacctatgacaaaacgccgctggagaaggatggcatcaccgttgtggactggccgtttgacgatggggcgcccccgcccggcaaggtagtggaagactggctgagcctggtgaaggccaagttctgtgaggcccccggcagctgcgtggctgtgcactgcgtggcgggcctgggccggaagcgccgcggagccatcaacagcaagcagctcacctacctggagaaataccggcccaaacagaggctgcggttcaaagacccacacacgcacaagacccggtgctgcgttatgtag
Vector:	pDONR223
Delivery lead time in business days in europe:	10-12 days
Storage:	-20â„ƒ
Delivery condition:	Blue Ice
Related products:	- acyl-CoA synthetase medium-chain family member 5 - CDC42 effector protein (Rho GTPase binding) 3 - ATPase, Na+/K+ transporting, beta 1 polypeptide - activity-regulated cytoskeleton-associated protein

Reviews

Be the first to write your review !

Buy PTP4A3-protein tyrosine phosphatase type IVA, member 3 Gene now