Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of HBG1-hemoglobin, gamma A Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about HBG1-hemoglobin, gamma A Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC010913 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | HBG1 |
| Origin species: | Human |
| Product name: | HBG1-hemoglobin, gamma A Gene |
| Size: | 2ug |
| Accessions: | BC010913 |
| Gene id: | 3047 |
| Gene description: | hemoglobin, gamma A |
| Synonyms: | HBG-T2; HBGA; HBGR; HSGGL1; PRO2979; hemoglobin subunit gamma-1; A-gamma globin; gamma A hemoglobin; gamma globin; gamma-1-globin; hb F Agamma; hemoglobin gamma-1 chain; hemoglobin gamma-a chain; hemoglobin, gamma A; hemoglobin, gamma, regulator of; hemoglobin subunit gamma 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgggtcatttcacagaggaggacaaggctactatcacaagcctgtggggcaaggtgaatgtggaagatgctggaggagaaaccctgggaaggctcctggttgtctacccatggacccagaggttctttgacagctttggcaacctgtcctctgcctctgccatcatgggcaaccccaaagtcaaggcacatggcaagaaggtgctgacttccttgggagatgccacaaagcacctggatgatctcaagggcacctttgcccagctgagtgaactgcactgtgacaagctgcatgtggatcctgagaacttcaagctcctgggaaatgtgctggtgaccgttttggcaatccatttcggcaaagaattcacccctgaggtgcaggcttcctggcagaagatggtgactgcagtggccagtgccctgtcctccagataccactga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - apolipoprotein A-I - thioredoxin-like 1 - follistatin-like 1 - chloride channel 2 |