Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of TSC22D1-TSC22 domain family, member 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about TSC22D1-TSC22 domain family, member 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC000456 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | TSC22D1 |
| Origin species: | Human |
| Product name: | TSC22D1-TSC22 domain family, member 1 Gene |
| Size: | 2ug |
| Accessions: | BC000456 |
| Gene id: | 8848 |
| Gene description: | TSC22 domain family, member 1 |
| Synonyms: | Ptg-2; TGFB1I4; TSC22; TSC22 domain family protein 1; TGFB-stimulated clone 22 homolog; TGFbeta-stimulated clone 22; cerebral protein 2; regulatory protein TSC-22; transcriptional regulator TSC-22; transforming growth factor beta-1-induced transcript 4 protein; transforming growth factor beta-stimulated protein TSC-22; TSC22 domain family member 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaaatcccaatggtgtagaccagtggcgatggatctaggagtttaccaactgagacatttttcaatttctttcttgtcatccttgctggggactgaaaacgcttctgtgagacttgataatagctcctctggtgcaagtgtggtagctattgacaacaaaatcgagcaagctatggatctagtgaaaagccatttgatgtatgcggtcagagaagaagtggaggtcctcaaagagcaaatcaaagaactaatagagaaaaattcccagctggagcaggagaacaatctgctgaagacactggccagtcctgagcagcttgcccagtttcaggcccagctgcagactggctccccccctgccaccacccagccacagggcaccacacagccccccgcccagccagcatcgcagggctcaggaccaaccgcatag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - Wilms tumor 1 associated protein - ubiquitously-expressed transcript - slingshot homolog 2 (Drosophila) - ubiquitin specific peptidase 53 |