RPL23-ribosomal protein L23 Gene View larger

RPL23-ribosomal protein L23 Gene

PTXBC010114

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of RPL23-ribosomal protein L23 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about RPL23-ribosomal protein L23 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC010114
Product type: DNA & cDNA
Ncbi symbol: RPL23
Origin species: Human
Product name: RPL23-ribosomal protein L23 Gene
Size: 2ug
Accessions: BC010114
Gene id: 9349
Gene description: ribosomal protein L23
Synonyms: L23; rpL17; 60S ribosomal protein L23; 60S ribosomal protein L17; ribosomal protein L17; ribosomal protein L23
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtcgaagcgaggacgtggtgggtcctctggtgcgaaattccggatttccttgggtcttccggtaggagctgtaatcaattgtgctgacaacacaggagccaaaaacctgtatatcatctccgtgaaggggatcaagggacggctgaacagacttcccgctgctggtgtgggtgacatggtgatggccacagtcaagaaaggcaaaccagagctcagaaaaaaggtacatccagcagtggtcattcgacaacgaaagtcataccgtagaaaagatggcgtgtttctttattttgaagataatgcaggagtcatagtgaacaataaaggcgagatgaaaggttctgccattacaggaccagtagcaaaggagtgtgcagacttgtggccccggattgcatccaatgctggcagcattgcatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - carbonic anhydrase XII
- testis expressed 261
- ribosomal protein S11
- titin-cap (telethonin)

Reviews

Buy RPL23-ribosomal protein L23 Gene now

Add to cart