Cart 19 Product Products 2 455,26 € (empty)
-
1 x C3orf37-ch...121,50 € -
1 x CRYBA4-cry...113,40 € -
1 x TMEM184A-t...121,50 € -
1 x RWDD2A-RWD...121,50 € -
1 x UBA6-ubiqu...121,50 € -
1 x KIAA1305-K...113,40 € -
-
1 x HMGB4-high...113,40 € -
1 x TMEM44-tra...113,40 € -
1 x TNFRSF14-t...121,50 € -
1 x TFB2M-tran...121,50 € -
1 x PSMC6-prot...121,50 € -
1 x TUBB6-tubu...121,50 € -
1 x RAD51L1-RA...121,50 € -
1 x MICA-MHC...121,50 € -
1 x C4BPB-comp...113,40 € -
1 x C15orf49-c...113,40 € -
1 x C3orf60-ch...113,40 € -
1 x C10orf65-c...121,50 €
No products
To be determined Shipping
2 455,26 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 19 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 2 455,26 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 2 455,26 €
Data sheet of SHISA5-shisa homolog 5 (Xenopus laevis) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about SHISA5-shisa homolog 5 (Xenopus laevis) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC001463 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SHISA5 |
| Origin species: | Human |
| Product name: | SHISA5-shisa homolog 5 (Xenopus laevis) Gene |
| Size: | 2ug |
| Accessions: | BC001463 |
| Gene id: | 51246 |
| Gene description: | shisa homolog 5 (Xenopus laevis) |
| Synonyms: | SCOTIN; protein shisa-5; shisa homolog 5; shisa family member 5 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggggttcggagcgaccttggccgttggcctgaccatctttgtgctgtctgtcgtcactatcatcatctgcttcacctgctcctgctgctgcctttacaagacgtgccgccgaccacgtccggttgtcaccaccaccacatccaccactgtggtgcatgccccttatcctcagcctccaagtgtgccgcccagctaccctggaccaagctaccagggctaccacaccatgccgcctcagccagggatgccagcagcaccctacccaatgcagtacccaccaccttacccagcccagcccatgggcccaccggcctaccacgagaccctggctggaggagcagccgcgccctaccccgccagccagcctccttacaacccggcctacatggatgccccgaaggcggccctctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - signal recognition particle 19kDa - mal, T-cell differentiation protein - cytoskeleton associated protein 2 - GTP-binding protein 8 (putative) |