Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
ATP5G1-ATP synthase, H+ transporting, mitochondrial F0 complex, subunit C1 (subunit 9) Gene
PTXBC004963
New product
Data sheet of ATP5G1-ATP synthase, H+ transporting, mitochondrial F0 complex, subunit C1 (subunit 9) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about ATP5G1-ATP synthase, H+ transporting, mitochondrial F0 complex, subunit C1 (subunit 9) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC004963 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | ATP5G1 |
| Origin species: | Human |
| Product name: | ATP5G1-ATP synthase, H+ transporting, mitochondrial F0 complex, subunit C1 (subunit 9) Gene |
| Size: | 2ug |
| Accessions: | BC004963 |
| Gene id: | 516 |
| Gene description: | ATP synthase, H+ transporting, mitochondrial F0 complex, subunit C1 (subunit 9) |
| Synonyms: | ATP5A; ATP5G; ATP synthase F(0) complex subunit C1, mitochondrial; ATP synthase lipid-binding protein, mitochondrial; ATP synthase proteolipid P1; ATP synthase proton-transporting mitochondrial F(0) complex subunit C1; ATP synthase, H+ transporting, mitochondrial F0 complex, subunit C1 (subunit 9); ATP synthase, H+ transporting, mitochondrial F0 complex, subunit c (subunit 9); ATPase protein 9; ATPase subunit 9; ATPase subunit C; mitochondrial ATP synthase, subunit 9; mitochondrial ATP synthase, subunit C; ATP synthase, H+ transporting, mitochondrial Fo complex subunit C1 (subunit 9) |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgcagaccgccggggcattattcatttctccagctctgatccgctgttgtaccaggggtctaatcaggcctgtgtctgcctccttcttgaatagcccagtgaattcatctaaacagccttcctacagcaacttcccactccaggtggccagacgggagttccagaccagtgttgtctcccgggacattgacacagcagccaagtttattggtgctggggcagccacagttggtgtggctggttcaggggctggcattggaaccgtgtttggcagcttgatcattggctatgccaggaacccttctctcaagcagcagctcttctcctatgccattcttggctttgccctgtctgaggccatggggcttttctgtttgatggtcgccttcctcatcctcttcgccatgtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - TAF11 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 28kDa - signal transducer and activator of transcription 3 (acute-phase response factor) - TAF12 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 20kDa - 5,10-methenyltetrahydrofolate synthetase (5-formyltetrahydrofolate cyclo-ligase) |