Cart 9 Product Products 1 028,70 € (empty)
-
1 x ACSM5-acyl...113,40 € -
1 x C1orf211-c...113,40 € -
1 x FCGR3A-Fc...113,40 € -
1 x DPY19L3-dp...113,40 € -
1 x FTH1-ferri...113,40 € -
1 x FAM118B-fa...121,50 € -
1 x HLA-DQB1-m...113,40 € -
1 x COMMD2-COM...113,40 € -
1 x H2AFV-H2A...113,40 €
No products
To be determined Shipping
1 028,70 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 9 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 1 028,70 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 1 028,70 €
Data sheet of TMEM100-transmembrane protein 100 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about TMEM100-transmembrane protein 100 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC010128 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | TMEM100 |
| Origin species: | Human |
| Product name: | TMEM100-transmembrane protein 100 Gene |
| Size: | 2ug |
| Accessions: | BC010128 |
| Gene id: | 55273 |
| Gene description: | transmembrane protein 100 |
| Synonyms: | transmembrane protein 100 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgactgaagagcccatcaaggagatcctgggagccccaaaggctcacatggcagcgacgatggagaagagccccaagagtgaagttgtgatcaccacagtccctctggtcagtgagattcagttgatggctgctacagggggtaccgagctctcctgctaccgctgcatcatcccctttgctgtggttgtcttcatcgccggcatcgtggtcaccgcggtggcttacagcttcaattcccatgggtctattatctccatctttggcctggttgttctgtcatctggactttttttactagcctccagtgccttgtgctggaaagtgagacaaaggagcaagaaagccaagagacgggagagtcaaacagctctcgtggcaaatcagagaagcttgtttgcttga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - transmembrane protein 203 - enabled homolog (Drosophila) - translocator protein (18kDa) - transmembrane protein 208 |