Cart 25 Product Products 3 685,17 € (empty)
-
1 x DUSP3-dual...113,40 € -
1 x EFCAB1-EF-...113,40 € -
-
1 x OR2K2-olfa...121,50 € -
1 x MYL6B-myos...113,40 € -
1 x XAGE3-X...113,40 € -
-
-
-
1 x PRR16-prol...113,40 € -
-
1 x RPL3-ribos...121,50 € -
-
-
-
1 x Cyclophilin A744,00 € -
-
1 x ZNF3-zinc...121,50 € -
-
1 x FBXO8-F-bo...121,50 € -
1 x C22orf34-c...113,40 € -
-
-
-
1 x NDUFV2-NAD...113,40 €
No products
To be determined Shipping
3 685,17 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 25 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 3 685,17 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 3 685,17 €
View larger 
LSM1-LSM1 homolog, U6 small nuclear RNA associated (S. cerevisiae) Gene
PTXBC001767
New product
Data sheet of LSM1-LSM1 homolog, U6 small nuclear RNA associated (S. cerevisiae) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about LSM1-LSM1 homolog, U6 small nuclear RNA associated (S. cerevisiae) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC001767 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | LSM1 |
| Origin species: | Human |
| Product name: | LSM1-LSM1 homolog, U6 small nuclear RNA associated (S. cerevisiae) Gene |
| Size: | 2ug |
| Accessions: | BC001767 |
| Gene id: | 27257 |
| Gene description: | LSM1 homolog, U6 small nuclear RNA associated (S. cerevisiae) |
| Synonyms: | LSM1 homolog, mRNA degradation associated; LSM1-like protein U6 small nuclear RNA associated; LSM1, U6 small nuclear RNA associated; LSM1 mRNA degradation associated; LSM1 homolog, U6 small nuclear RNA associated; U6 snRNA-associated Sm-like protein LSm1; CASM; YJL124C; cancerâ€associated Sm protein; cancer-associated Sm protein; cancer-associated Sm-like protein; small nuclear ribonuclear CaSm |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaactatatgcctggcaccgccagcctcatcgaggacattgacaaaaagcacttggttctgcttcgagatggaaggacacttataggctttttaagaagcattgatcaatttgcaaacttagtgctacatcagactgtggagcgtattcatgtgggcaaaaaatacggtgatattcctcgagggatttttgtggtcagaggagaaaatgtggtcctactaggagaaatagacttggaaaaggagagtgacacacccctccagcaagtatccattgaagaaattctagaagaacaaagggtggaacagcagaccaagctggaagcagagaagttgaaagtgcaggccctgaaggaccgaggtctttccattcctcgagcagatactcttgatgagtactaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - mesoderm induction early response 1 homolog (Xenopus laevis) - NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 8, 19kDa - COX11 homolog, cytochrome c oxidase assembly protein (yeast) - proteasome (prosome, macropain) 26S subunit, non-ATPase, 12 |