Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
SNRNP25-small nuclear ribonucleoprotein 25kDa (U11/U12) Gene
PTXBC001381
New product
Data sheet of SNRNP25-small nuclear ribonucleoprotein 25kDa (U11/U12) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about SNRNP25-small nuclear ribonucleoprotein 25kDa (U11/U12) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC001381 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SNRNP25 |
| Origin species: | Human |
| Product name: | SNRNP25-small nuclear ribonucleoprotein 25kDa (U11/U12) Gene |
| Size: | 2ug |
| Accessions: | BC001381 |
| Gene id: | 79622 |
| Gene description: | small nuclear ribonucleoprotein 25kDa (U11/U12) |
| Synonyms: | C16orf33; U11/U12 small nuclear ribonucleoprotein 25 kDa protein; U11/U12 snRNP 25 kDa protein; U11/U12 snRNP 25K; minus-99 protein; small nuclear ribonucleoprotein 25kDa (U11/U12); small nuclear ribonucleoprotein, U11/U12 25kDa subunit; small nuclear ribonucleoprotein U11/U12 subunit 25 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggacgtgttccaggagggtctggctatggtggtgcaggacccgctgctctgcgatctgccgatccaggttactctggaagaagtcaactcccaaatagccctagaatacggccaggcaatgacggtccgagtgtgcaagatggatggagaagtaatgcccgtggttgtagtgcagagtgccacagtcctggacctgaagaaggccatccagagatacgtgcagctcaagcaggagcgtgaagggggcattcagcacatcagctggtcctacgtgtggaggacgtaccatctgacctctgcaggagagaaactcacggaagacagaaagaagctccgagactacggcatccggaatcgagacgaggtttccttcatcaaaaagctgaggcaaaagtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - polymerase (RNA) II (DNA directed) polypeptide D - FUS interacting protein (serine/arginine-rich) 1 - FUS interacting protein (serine/arginine-rich) 1 - RNA pseudouridylate synthase domain containing 4 |