SPIRE1-spire homolog 1 (Drosophila) Gene

View larger

SPIRE1-spire homolog 1 (Drosophila) Gene

Reference: PTXBC016825

Condition: New product

Print

Data sheet of SPIRE1-spire homolog 1 (Drosophila) Gene

Brand	ProteoGenix
Product type	DNA & cDNA
Origin species	Human

More info about SPIRE1-spire homolog 1 (Drosophila) Gene

Brand:	ProteoGenix
Proteogenix catalog:	PTXBC016825
Product type:	DNA & cDNA
Ncbi symbol:	SPIRE1
Origin species:	Human
Product name:	SPIRE1-spire homolog 1 (Drosophila) Gene
Size:	2ug
Accessions:	BC016825
Gene id:	56907
Gene description:	spire homolog 1 (Drosophila)
Synonyms:	Spir-1; protein spire homolog 1; spire actin nucleation factor 1; spire family actin nucleation factor 1; spire homolog 1; spire type actin nucleation factor 1
Sequence primers:	Forward primer M13R (5'â†’3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â†’3'): TAATACGACTCACTATAGG
Orf sequence:	atgcggctgccctccaaaccatactccactcttcctatcttttcattgggaccttctgctctgcaaagaggggaaagtagtatgaggtcagaaaaaccctccactgcccatcatcggccacttcggagcattgccaggttctcctcaaaatctaagtctatggacaaatcagatgaagaactccagtttcccaaagagttgatggaggactggagcaccatggaggtgtgtgtggactgcaagaagttcatttcggaaatcatcagttcaagccggcgcagtctggtgttggccaacaaaagggcccgattgaaaaggaaaacgcagtctttctacatgtcctcgccaggcccctcggagtactgcccttcagagaggacgatcagtgagatctga
Vector:	pDONR223
Delivery lead time in business days in europe:	10-12 days
Storage:	-20â„ƒ
Delivery condition:	Blue Ice
Related products:	- LY6/PLAUR domain containing 1 - ISG15 ubiquitin-like modifier - ADP-ribosylation factor-like 2 - armadillo repeat containing 7

Reviews

Be the first to write your review !

Buy SPIRE1-spire homolog 1 (Drosophila) Gene now