MMP28-matrix metallopeptidase 28 Gene View larger

MMP28-matrix metallopeptidase 28 Gene

PTXBC011774

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MMP28-matrix metallopeptidase 28 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about MMP28-matrix metallopeptidase 28 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC011774
Product type: DNA & cDNA
Ncbi symbol: MMP28
Origin species: Human
Product name: MMP28-matrix metallopeptidase 28 Gene
Size: 2ug
Accessions: BC011774
Gene id: 79148
Gene description: matrix metallopeptidase 28
Synonyms: EPILYSIN; MM28; MMP-25; MMP-28; MMP25; matrix metalloproteinase-28; matrix metalloprotease MMP25; matrix metallopeptidase 28
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggtcgcgcgcgtcggcctcctgctgcgcgccctgcagctgctactgtggggccacctggacgcccagcccgcggagcgcggaggccaggagctgcgcaaggaggcggaggcattcctagagaagtacggatacctcaatgaacaggtccccaaagctcccacctccactcgattcagcgatgccatcagagcgtttcagtgggtgtcccagctacctgtcagcggcgtgttggaccgcgccaccctgcgccagatgactcgtccccgctgcggggttacagataccaacagttatgcggcctgggctgagaggatcagtgacttgtttgctagacaccggaccaaaatgaggcgtaagaaacgctttgcaaagcaaggtgagcactgttaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - histone acetyltransferase 1
- DEP domain containing 1B
- LMBR1 domain containing 1
- ankyrin repeat domain 22

Reviews

Buy MMP28-matrix metallopeptidase 28 Gene now

Add to cart