> >>LRP12-low density lipoprotein-related protein 12 Gene
LRP12-low density lipoprotein-related protein 12 Gene View larger

LRP12-low density lipoprotein-related protein 12 Gene

PTXBC017381

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language
Rate it

Data sheet of LRP12-low density lipoprotein-related protein 12 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about LRP12-low density lipoprotein-related protein 12 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC017381
Product type: DNA & cDNA
Ncbi symbol: LRP12
Origin species: Human
Product name: LRP12-low density lipoprotein-related protein 12 Gene
Size: 2ug
Accessions: BC017381
Gene id: 29967
Gene description: low density lipoprotein-related protein 12
Synonyms: ST7; low-density lipoprotein receptor-related protein 12; suppressor of tumorigenicity 7 protein; LDL receptor related protein 12
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaagatattctactatgcattaaatcttgaactttataaaacatgtacaaaaattgtacaagataagttccacctggtaatgtctttccctaatacagggttgcgcttgcattggaccctagggatttgcactaaaattatatcaaggtctcagatgagcttagtgcacaagcactatcactttaaatactattatttgctaccacagcaactatatatttccatagcttttggctgggggcgggggacatttttattacaacttgaaattgctttgctggtttcatatttatttgttgtatttaaaaaatacattgttgtaagagtgattttttcaatatattttattcctgggggggatcatgctacactctcaaaagaaaattaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - BCL2-interacting killer (apoptosis-inducing)
- collagen triple helix repeat containing 1
- heterogeneous nuclear ribonucleoprotein F
- PX domain containing serine/threonine kinase

Reviews

Buy LRP12-low density lipoprotein-related protein 12 Gene now

Add to cart