> >>LLPH-LLP homolog, long-term synaptic facilitation (Aplysia) Gene
LLPH-LLP homolog, long-term synaptic facilitation (Aplysia) Gene View larger

LLPH-LLP homolog, long-term synaptic facilitation (Aplysia) Gene

PTXBC006002

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language
Rate it

Data sheet of LLPH-LLP homolog, long-term synaptic facilitation (Aplysia) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about LLPH-LLP homolog, long-term synaptic facilitation (Aplysia) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC006002
Product type: DNA & cDNA
Ncbi symbol: LLPH
Origin species: Human
Product name: LLPH-LLP homolog, long-term synaptic facilitation (Aplysia) Gene
Size: 2ug
Accessions: BC006002
Gene id: 84298
Gene description: LLP homolog, long-term synaptic facilitation (Aplysia)
Synonyms: C12orf31; hLLP; protein LLP homolog; LLP homolog, long-term synaptic facilitation (Aplysia); human LAPS18-like protein; LLP homolog, long-term synaptic facilitation
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggctaaaagcttacggagtaagtggaaaagaaagatgcgtgctgaaaagagaaaaaagaatgccccaaaggaggccagcaggcttaaaagtattctcaaactagacggtgatgttttaatgaaagatgttcaagagatagcaactgtggtggtacccaaacccaaacattgccaagagaaaatgcaatgtgaggtaaaagatgaaaaagatgacatgaaaatggagactgatattaagagaaacaaaaagactcttctagaccagcatggacagtacccaatatggatgaaccaaaggcaaagaaaaaggctgaaggcaaagcgagagaaaagaaaggggaaaagcaaagcaaaagcagtgaaagtggcaaagggtttggcctggtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - proteasome (prosome, macropain) subunit, beta type, 3
- coenzyme Q3 homolog, methyltransferase (S. cerevisiae)
- major histocompatibility complex, class II, DO beta
- proline synthetase co-transcribed homolog (bacterial)

Reviews

Buy LLPH-LLP homolog, long-term synaptic facilitation (Aplysia) Gene now

Add to cart