Cart 2 Product Products 380,57 € (empty)
-
1 x CCDC112-co...121,50 € -
1 x ALK-1...259,07 €
No products
To be determined Shipping
380,57 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 2 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 380,57 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 380,57 €
Data sheet of MRPS14-mitochondrial ribosomal protein S14 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about MRPS14-mitochondrial ribosomal protein S14 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC009788 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | MRPS14 |
| Origin species: | Human |
| Product name: | MRPS14-mitochondrial ribosomal protein S14 Gene |
| Size: | 2ug |
| Accessions: | BC009788 |
| Gene id: | 63931 |
| Gene description: | mitochondrial ribosomal protein S14 |
| Synonyms: | DJ262D12.2; HSMRPS14; MRP-S14; S14mt; 28S ribosomal protein S14, mitochondrial; mitochondrial 28S ribosomal protein S14; mitochondrial ribosomal protein S14 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcggccttcatgctgggctcgctgctgcggacgttcaagcagatggttccttcatcagcttcaggccaagttcgaagtcactatgtagactggagaatgtggcgcgatgtgaagagacgaaaaatggcctatgaatacgcagatgagaggctacgtattaattcactcaggaagaataccattttgccaaaaattcttcaggatgtggctgatgaagaaattgctgccctcccccgggatagctgtcctgttagaatcagaaatcggtgtgttatgacgtcccgtccgcgtggtgtgaagcggcgctggaggcttagtcgtatagtcttccgtcacttagctgaccatgggcaactttctgggatccagcgagcgacatggtaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - mitochondrial ribosomal protein L20 - chromosome 8 open reading frame 44 - mitochondrial ribosomal protein S24 - zinc finger CCCH-type containing 7A |