Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
NHP2L1-NHP2 non-histone chromosome protein 2-like 1 (S. cerevisiae) Gene
PTXBC005358
New product
Data sheet of NHP2L1-NHP2 non-histone chromosome protein 2-like 1 (S. cerevisiae) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about NHP2L1-NHP2 non-histone chromosome protein 2-like 1 (S. cerevisiae) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC005358 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | NHP2L1 |
| Origin species: | Human |
| Product name: | NHP2L1-NHP2 non-histone chromosome protein 2-like 1 (S. cerevisiae) Gene |
| Size: | 2ug |
| Accessions: | BC005358 |
| Gene id: | 4809 |
| Gene description: | NHP2 non-histone chromosome protein 2-like 1 (S. cerevisiae) |
| Synonyms: | NHP2L1; 15.5K; FA-1; FA1; NHPX; OTK27; SNRNP15-5; SPAG12; SSFA1; NHP2-like protein 1; NHP2 non-histone chromosome protein 2-like 1; U4/U6.U5 tri-snRNP 15.5 kDa protein; [U4/U6.U5] tri-snRNP 15.5 kD RNA binding protein; high mobility group-like nuclear protein 2 homolog 1; non-histone chromosome protein 2-like 1; sperm specific antigen 1; SNU13 homolog, small nuclear ribonucleoprotein (U4/U6.U5) |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgactgaggctgatgtgaatccaaaggcctacccccttgccgatgcccacctcaccaagaagctactggacctcgttcagcagtcatgtaactataagcagcttcggaaaggagccaatgaggccaccaaaaccctcaacaggggcatctctgagttcatcgtgatggctgcagacgccgagccactggagatcattctgcacctgccgctgctgtgtgaagacaagaatgtgccctacgtgtttgtgcgctccaagcaggccctggggagagcctgtggggtctccaggcctgtcatcgcctgttctgtcaccatcaaagaaggctcgcagctgaaacagcagatccaatccattcagcagtccattgaaaggctcttagtctaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - mitochondrial rRNA methyltransferase 1 homolog (S. cerevisiae) - potassium voltage-gated channel, Isk-related family, member 4 - protein kinase, AMP-activated, gamma 1 non-catalytic subunit - protein phosphatase 2, regulatory subunit B', gamma isoform |