Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
GNB5-guanine nucleotide binding protein (G protein), beta 5 Gene
PTXBC011671
New product
Data sheet of GNB5-guanine nucleotide binding protein (G protein), beta 5 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about GNB5-guanine nucleotide binding protein (G protein), beta 5 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC011671 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | GNB5 |
| Origin species: | Human |
| Product name: | GNB5-guanine nucleotide binding protein (G protein), beta 5 Gene |
| Size: | 2ug |
| Accessions: | BC011671 |
| Gene id: | 10681 |
| Gene description: | guanine nucleotide binding protein (G protein), beta 5 |
| Synonyms: | GB5; IDDCA; LADCI; guanine nucleotide-binding protein subunit beta-5; G protein, beta subunit 5L; G protein, beta-5 subunit; gbeta5; guanine nucleotide binding protein (G protein), beta 5; guanine nucleotide-binding protein, beta subunit 5L; transducin beta chain 5; G protein subunit beta 5 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcaaccgaggggctgcacgagaacgagacgctggcgtcgctgaagagcgaggccgagagcctcaagggcaagctggaggaggagcgagccaagctgcacgatgtggagctgcaccaggtggcggagcgggtggaggccctggggcagtttgtcatgaagaccagaaggaccctcaaaggccacgggaacaaagtcctgtgcatggactggtgcaaagataagaggaggatcgtgagctcgtcacaggatgggaaggtgatcgtgtgggattccttcaccacaaacaaggtgaggcattgttcccagccacgttatagaggcttcagaatcccagcctacttaaaggtgctctggtccagctgcccggccctgtcctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - LLP homolog, long-term synaptic facilitation (Aplysia) - proteasome (prosome, macropain) subunit, beta type, 3 - coenzyme Q3 homolog, methyltransferase (S. cerevisiae) - major histocompatibility complex, class II, DO beta |