RPL31-ribosomal protein L31 Gene

View larger

RPL31-ribosomal protein L31 Gene

Reference: PTXBC017343

Condition: New product

Print

Data sheet of RPL31-ribosomal protein L31 Gene

Brand	ProteoGenix
Product type	DNA & cDNA
Origin species	Human

More info about RPL31-ribosomal protein L31 Gene

Brand:	ProteoGenix
Proteogenix catalog:	PTXBC017343
Product type:	DNA & cDNA
Ncbi symbol:	RPL31
Origin species:	Human
Product name:	RPL31-ribosomal protein L31 Gene
Size:	2ug
Accessions:	BC017343
Gene id:	6160
Gene description:	ribosomal protein L31
Synonyms:	L31; 60S ribosomal protein L31; ribosomal protein L31
Sequence primers:	Forward primer M13R (5'â†’3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â†’3'): TAATACGACTCACTATAGG
Orf sequence:	atggctcccgcaaagaagggtggcgagaagaaaaagggccgttctgccatcaacgaagtggtaacccgagaatacaccatcaacattcacaagcgcatccatggagtgggcttcaagaagcgtgcacctcgggcactcaaagagattcggaaatttgccatgaaggagatgggaactccagatgtgcgcattgacaccaggctcaacaaagctgtctgggccaaaggaataaggaatgtgccataccgaatccgtgtgcggctgtccagaaaacgtaatgaggatgaagattcaccaaataagctatatactttggttacctatgtacctgttaccactttcaaaaatctacagacagtcaatgtggatgagaactaa
Vector:	pDONR223
Delivery lead time in business days in europe:	10-12 days
Storage:	-20â„ƒ
Delivery condition:	Blue Ice
Related products:	- ribosomal protein S24 - ribosomal protein S12 - ribosomal protein S17 - ribosomal protein L28

Reviews

Be the first to write your review !

Buy RPL31-ribosomal protein L31 Gene now