Cart 2 Product Products 244,42 € (empty)
-
-
1 x ADA-adenos...121,50 €
No products
To be determined Shipping
244,42 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 2 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 244,42 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 244,42 €
Data sheet of RPS25-ribosomal protein S25 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about RPS25-ribosomal protein S25 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC003537 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | RPS25 |
| Origin species: | Human |
| Product name: | RPS25-ribosomal protein S25 Gene |
| Size: | 2ug |
| Accessions: | BC003537 |
| Gene id: | 6230 |
| Gene description: | ribosomal protein S25 |
| Synonyms: | S25; 40S ribosomal protein S25 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgccgcctaaggacgacaagaagaagaaggacgctggaaagtcggccaagaaagacaaagacccagtgaacaaatccgggggcaaggccaaaaagaagaagtggtccaaaggcaaagttcgggacaagctcaataacttagtcttgtttgacaaagctacctatgataaactctgtaaggaagttcccaactataaacttataaccccagctgtggtctctgagagactgaagattcgaggctccctggccagggcagcccttcaggagctccttagtaaaggacttatcaaactggtttcaaagcacagagctcaagtaatttacaccagaaataccaagggtggagatgctccagctgctggtgaagatgcatga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - ribosomal protein L31 - ribosomal protein S24 - ribosomal protein S12 - ribosomal protein S17 |