TNFRSF21-tumor necrosis factor receptor superfamily, member 21 Gene

View larger

TNFRSF21-tumor necrosis factor receptor superfamily, member 21 Gene

Reference: PTXBC005192

Condition: New product

Print

Data sheet of TNFRSF21-tumor necrosis factor receptor superfamily, member 21 Gene

Brand	ProteoGenix
Product type	DNA & cDNA
Origin species	Human

More info about TNFRSF21-tumor necrosis factor receptor superfamily, member 21 Gene

Brand:	ProteoGenix
Proteogenix catalog:	PTXBC005192
Product type:	DNA & cDNA
Ncbi symbol:	TNFRSF21
Origin species:	Human
Product name:	TNFRSF21-tumor necrosis factor receptor superfamily, member 21 Gene
Size:	2ug
Accessions:	BC005192
Gene id:	27242
Gene description:	tumor necrosis factor receptor superfamily, member 21
Synonyms:	BM-018; CD358; tumor necrosis factor receptor superfamily member 21; TNFR-related death receptor 6; death receptor 6; TNF receptor superfamily member 21
Sequence primers:	Forward primer M13R (5'â†’3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â†’3'): TAATACGACTCACTATAGG
Orf sequence:	atgcaattcaactttgagttatcttttaaatatgtcttgtatagttcatattcatggctgaaacttgaccacactattgctgattgtatggttttcacctggacaccgtgtagaatgcttgattacttgtactcttcttatgctaatatgctctgggctggagaaatgaaatcctcaagccatcaggatttgctatttaagtggcttgacaactgggccaccaaagaacttgaacttcaccttttaggatttgagctgttctggaacacattgctgcactttggaaagtcaaaatcaagtgccagtggcgccctttccatagagaatttgcccagctttgctttaaaagatgtcttgttttttatatacacataa
Vector:	pDONR223
Delivery lead time in business days in europe:	10-12 days
Storage:	-20â„ƒ
Delivery condition:	Blue Ice
Related products:	- coiled-coil-helix-coiled-coil-helix domain containing 2 - N-6 adenine-specific DNA methyltransferase 1 (putative) - protein phosphatase 1, regulatory (inhibitor) subunit 8 - coiled-coil-helix-coiled-coil-helix domain containing 6

Reviews

Be the first to write your review !

Buy TNFRSF21-tumor necrosis factor receptor superfamily, member 21 Gene now