Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of FOSL2-FOS-like antigen 2 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about FOSL2-FOS-like antigen 2 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC008899 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | FOSL2 |
| Origin species: | Human |
| Product name: | FOSL2-FOS-like antigen 2 Gene |
| Size: | 2ug |
| Accessions: | BC008899 |
| Gene id: | 2355 |
| Gene description: | FOS-like antigen 2 |
| Synonyms: | FRA2; fos-related antigen 2; FOS like 2, AP-1 trancription factor subunit; FOS like antigen 2; FRA-2; FOS like 2, AP-1 transcription factor subunit |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgagcgtgggcctggaccttccccagatgctgccaggcagcccctccccaagcctcaaagaagcatttgctgaggatggagaggcaggggagggaggcgggaggccgtcactggagtggcgtctgcagcagctgctgccccagcacccgctcagcctgtcctggctgctcacctccccgcagggcaccgggcctttcctgccctctgtggtcatctgccacctgctggatcaagtgctttctcttttacactcccctgtccccaccccagtgcactcttctggcccaggcagcaagcaagctgtgaacagctggcctgagctgtcgctgtggcttgtggctcatgcgccattcctggttgtctgttga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - hemoglobin, gamma A - hemoglobin, gamma A - apolipoprotein A-I - thioredoxin-like 1 |