Cart 2 Product Products 234,90 € (empty)
-
1 x C12orf5-ch...121,50 € -
1 x LYRM2-LYR...113,40 €
No products
To be determined Shipping
234,90 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 2 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 234,90 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 234,90 €
View larger 
Data sheet of EPB41L3-erythrocyte membrane protein band 4.1-like 3 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about EPB41L3-erythrocyte membrane protein band 4.1-like 3 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC008377 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | EPB41L3 |
| Origin species: | Human |
| Product name: | EPB41L3-erythrocyte membrane protein band 4.1-like 3 Gene |
| Size: | 2ug |
| Accessions: | BC008377 |
| Gene id: | 23136 |
| Gene description: | erythrocyte membrane protein band 4.1-like 3 |
| Synonyms: | 4.1B; DAL-1; DAL1; band 4.1-like protein 3; differentially expressed in adenocarcinoma of the lung protein 1; erythrocyte membrane protein band 4.1 like 3 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgcagtgcaaagtgatacttctcgatggatcagaatatacctgtgatgtagagaaacgctccagaggacaagtgctgtttgataaagtgtgtgaacacttgaacttgctagagaaagactactttgggcttacgtatcgagatgctgaaaaccagaagaattggttggaccctgctaaggaaataaaaaaacaggttcgaagtggtgcttggcacttttcatttaatgtgaaattttatccaccagaccctgcccaactatctgaagatatcaccaggtactacctctgcttgcagttgcgagatgacatcgtgtccggaaggctgccctgctcctttgttaccctggccttgctgggctcctaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - DnaJ (Hsp40) homolog, subfamily B, member 12 - hematological and neurological expressed 1-like - protein disulfide isomerase family A, member 5 - DnaJ (Hsp40) homolog, subfamily C, member 17 |