Cart 1 Product Products 450,51 € (empty)
No products
To be determined Shipping
450,51 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 1 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 450,51 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 450,51 €
Data sheet of HHLA3-HERV-H LTR-associating 3 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about HHLA3-HERV-H LTR-associating 3 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC010922 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | HHLA3 |
| Origin species: | Human |
| Product name: | HHLA3-HERV-H LTR-associating 3 Gene |
| Size: | 2ug |
| Accessions: | BC010922 |
| Gene id: | 11147 |
| Gene description: | HERV-H LTR-associating 3 |
| Synonyms: | HERV-H LTR-associating protein 3; human endogenous retrovirus-H long terminal repeat-associating 3; human endogenous retrovirus-H long terminal repeat-associating protein 3; HERV-H LTR-associating 3 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgttcggtgcatgttataaacaaccacttaaaccctccggatctgagcctcccgcagaggaatgcagaatgacgccacggcacgcaggatgtgatgtcaccgagatgcagaggatactcagtcaaccaacatttactgagcatctacttcgtgccgtatgtcttgtcaacggaaaggggtccctatccagaccccaagagagcattcttggatctcttgcaagaaagaatttgaggcgaatccatagagtaagcttagtgatgtgtgtcagacctctgagcccaagcaaagccatcatatcccctgtgacctgcatgtatacatccagatggcctgaagcaagtgaagaatcacaaaagaagtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - zinc finger protein 587 - ring finger protein 111 - ArfGAP with FG repeats 2 - zinc finger protein 576 |