RPL23AP7-ribosomal protein L23a pseudogene 7 Gene View larger

RPL23AP7-ribosomal protein L23a pseudogene 7 Gene

PTXBC000596

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of RPL23AP7-ribosomal protein L23a pseudogene 7 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about RPL23AP7-ribosomal protein L23a pseudogene 7 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC000596
Product type: DNA & cDNA
Ncbi symbol: RPL23AP7
Origin species: Human
Product name: RPL23AP7-ribosomal protein L23a pseudogene 7 Gene
Size: 2ug
Accessions: BC000596
Gene id: 118433
Gene description: ribosomal protein L23a pseudogene 7
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtcactcaccttcaggcggcccaagacactgcgactccggaggcagcccagatatcctcagaagagcacccccaggagaaacaagcttggccactatgctatcatcaagtttccgctgaccactgagtcggccgtgaagaagatagaagaaaacaacacgcttgtgttcactgtggatgttaaagccaacaagcaccagatcagacaggctgtgaagaagctctatgacagtgatgtggccaaggtcaccaccctgatttgtcctgataaagagaagaaggcatatgttcgacttgctcctgattatgatgctttcaatgttgtaacaaaattgggatcacctaaactgagtccagctggctaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - LSM10, U7 small nuclear RNA associated
- chromosome 11 open reading frame 52
- chromosome 6 open reading frame 125
- chromosome 12 open reading frame 57

Reviews

Buy RPL23AP7-ribosomal protein L23a pseudogene 7 Gene now

Add to cart