Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of GABARAPL1-GABA(A) receptor-associated protein like 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about GABARAPL1-GABA(A) receptor-associated protein like 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC009309 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | GABARAPL1 |
| Origin species: | Human |
| Product name: | GABARAPL1-GABA(A) receptor-associated protein like 1 Gene |
| Size: | 2ug |
| Accessions: | BC009309 |
| Gene id: | 23710 |
| Gene description: | GABA(A) receptor-associated protein like 1 |
| Synonyms: | GABARAPL1-a; APG8-LIKE; APG8L; ATG8; ATG8B; ATG8L; GEC1; gamma-aminobutyric acid receptor-associated protein-like 1; GABA(A) receptor-associated protein-like 1; GEC-1; early estrogen-regulated protein; glandular epithelial cell protein 1; GABA type A receptor associated protein like 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaagttccagtacaaggaggaccatccctttgagtatcggaaaaaggaaggagaaaagatccggaagaaatatccggacagggtccccgtgattgtagagaaggctccaaaagccagggtgcctgatctggacaagaggaagtacctagtgccctctgaccttactgttggccagttctacttcttaatccggaagagaatccacctgagacctgaggacgccttattcttctttgtcaacaacaccatccctcccaccagtgctaccatgggccaactgtatgaggacaatcatgaggaagactattttctgtatgtggcctacagtgatgagagtgtctatgggaaatga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - erythrocyte membrane protein band 4.1-like 3 - DnaJ (Hsp40) homolog, subfamily B, member 12 - hematological and neurological expressed 1-like - protein disulfide isomerase family A, member 5 |