Cart 24 Product Products 2 792,98 € (empty)
-
1 x CHMP6-chro...113,40 € -
-
1 x KRR1-KRR1,...121,50 € -
1 x PVRL3-poli...121,50 € -
1 x SLC22A24-s...121,50 € -
1 x CTSE-cathe...121,50 € -
-
-
1 x CD34-CD34...121,50 € -
1 x NINJ2-ninj...113,40 € -
1 x MFSD5-majo...121,50 € -
-
-
1 x TWSG1-twis...113,40 € -
1 x PSPC1-para...121,50 € -
1 x FNTA-farne...113,40 € -
1 x FANCA-Fanc...121,50 € -
1 x OSBPL1A-ox...121,50 € -
1 x CHKB-choli...121,50 € -
-
-
1 x TPI1-trios...113,40 € -
-
No products
To be determined Shipping
2 792,98 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 24 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 2 792,98 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 2 792,98 €
Data sheet of PI3-peptidase inhibitor 3, skin-derived Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about PI3-peptidase inhibitor 3, skin-derived Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC010952 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | PI3 |
| Origin species: | Human |
| Product name: | PI3-peptidase inhibitor 3, skin-derived Gene |
| Size: | 2ug |
| Accessions: | BC010952 |
| Gene id: | 5266 |
| Gene description: | peptidase inhibitor 3, skin-derived |
| Synonyms: | ESI; SKALP; WAP3; WFDC14; cementoin; PI-3; WAP four-disulfide core domain 14; WAP four-disulfide core domain protein 14; elastase-specific inhibitor; peptidase inhibitor 3, skin-derived; pre-elafin; protease inhibitor 3, skin-derived (SKALP); protease inhibitor WAP3; skin-derived antileukoproteinase; trappin-2; peptidase inhibitor 3 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgagggccagcagcttcttgatcgtggtggtgttcctcatcgctgggacgctggttctagaggcagctgtcacgggagttcctgttaaaggtcaagacactgtcaaaggccgtgttccattcaatggacaagatcccgttaaaggacaagtttcagttaaaggtcaagataaagtcaaagcgcaagagccagtcaaaggtccagtctccactaagcctggctcctgccccattatcttgatccggtgcgccatgttgaatccccctaaccgctgcttgaaagatactgactgcccaggaatcaagaagtgctgtgaaggctcttgcgggatggcctgtttcgttccccagtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - shisa homolog 5 (Xenopus laevis) - signal recognition particle 19kDa - mal, T-cell differentiation protein - cytoskeleton associated protein 2 |