Cart 6 Product Products 2 772,78 € (empty)
-
1 x TNF-beta494,00 € -
1 x Trefoil...644,00 € -
1 x Testosterone544,00 € -
-
1 x TIMP-1494,00 € -
1 x TNF-alpha...494,00 €
No products
To be determined Shipping
2 772,78 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 6 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 2 772,78 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 2 772,78 €
Data sheet of GGCT-gamma-glutamyl cyclotransferase Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about GGCT-gamma-glutamyl cyclotransferase Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC005356 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | GGCT |
| Origin species: | Human |
| Product name: | GGCT-gamma-glutamyl cyclotransferase Gene |
| Size: | 2ug |
| Accessions: | BC005356 |
| Gene id: | 79017 |
| Gene description: | gamma-glutamyl cyclotransferase |
| Synonyms: | C7orf24; CRF21; GCTG; GGC; gamma-glutamylcyclotransferase; cytochrome c-releasing factor 21; gamma -glutamyl cyclotransferase |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggccaactcgggctgcaaggacgtcacgggtccagatgaggagagttttctgtactttgcctacggcagcaacctgctgacagagaggatccacctccgaaacccctcggcggcgttcttctgtgtggcccgcctgcaggattttaagcttgactttggcaattcccaaggcaaaacaagtcaaacttggcatggagggatagccaccatttttcagagtcctggcgatgaagtgtggggagtagtatggaaaatgaacaaaagcaatttaaattctctggatgaattatttgcatgggtgcaaaagaaaatggtttgccgctggagtatcaagagaagttaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - hypothetical protein HSPC152 - p53 and DNA damage regulated 1 - ribosomal protein L26-like 1 - allograft inflammatory factor 1 |