Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
FMC1-formation of mitochondrial complexes 1 homolog (S. cerevisiae) Gene
PTXBC008467
New product
Data sheet of FMC1-formation of mitochondrial complexes 1 homolog (S. cerevisiae) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about FMC1-formation of mitochondrial complexes 1 homolog (S. cerevisiae) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC008467 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | FMC1 |
| Origin species: | Human |
| Product name: | FMC1-formation of mitochondrial complexes 1 homolog (S. cerevisiae) Gene |
| Size: | 2ug |
| Accessions: | BC008467 |
| Gene id: | 154791 |
| Gene description: | formation of mitochondrial complexes 1 homolog (S. cerevisiae) |
| Synonyms: | C7orf55; HSPC268; UPF0562 protein C7orf55; formation of mitochondrial complexes 1 homolog; formation of mitochondrial complex V assembly factor 1 homolog |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcggccttagggtccccggcgcacacttttcgaggacttctgcgggagttgcgctacctgagcgcggccaccggccgaccctatcgcgacaccgcggcctatcggtaccttgtgaaggctttccgtgcacatcgggtcaccagtgaaaagttgtgcagagcccaacatgagcttcatttccaagctgccacctatctctgcctcctgcgtagcatccggaaacatgtggccctacatcaggaatttcatggcaagggtgagcgctcggtggaggagtctgctggcttggtgggtctcaagttgccccatcagcctggagggaagggctgggagccatga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - NHP2 non-histone chromosome protein 2-like 1 (S. cerevisiae) - mitochondrial rRNA methyltransferase 1 homolog (S. cerevisiae) - potassium voltage-gated channel, Isk-related family, member 4 - protein kinase, AMP-activated, gamma 1 non-catalytic subunit |