Cart 1 Product Products 113,40 € (empty)
-
1 x TAL2-T-cel...113,40 €
No products
To be determined Shipping
113,40 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 1 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 113,40 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 113,40 €
View larger 
Data sheet of UQCRB-ubiquinol-cytochrome c reductase binding protein Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about UQCRB-ubiquinol-cytochrome c reductase binding protein Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC005230 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | UQCRB |
| Origin species: | Human |
| Product name: | UQCRB-ubiquinol-cytochrome c reductase binding protein Gene |
| Size: | 2ug |
| Accessions: | BC005230 |
| Gene id: | 7381 |
| Gene description: | ubiquinol-cytochrome c reductase binding protein |
| Synonyms: | MC3DN3; QCR7; QP-C; QPC; UQBC; UQBP; UQCR6; UQPC; cytochrome b-c1 complex subunit 7; complex III subunit 7; complex III subunit VII; mitochondrial ubiquinone-binding protein; ubiquinol-cytochrome c reductase complex 14 kDa protein; ubiquinol-cytochrome c reductase, complex III subunit VI; ubiquinol-cytochrome c reductase binding protein |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggctggtaagcaggccgtttcagcatcaggcaagtggctggatggtattcgaaaatggtattacaatgctgcaggattcaataaactggggttaatgcgagatgatacaatatacgaggatgaagatgtaaaagaagccataagaagacttcctgagaacctttataatgacaggatgtttcgcattaagagggcactggacctgaacttgaagcatcagatcttgcctaaagagcagtggaccaaatatgaagaggaaaatttctaccttgaaccgtatctgaaagaggttattcgggaaagaaaagaaagagaagaatgggcaaagaagtaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - leucine zipper, down-regulated in cancer 1-like - P antigen family, member 5 (prostate associated) - protein tyrosine phosphatase type IVA, member 3 - acyl-CoA synthetase medium-chain family member 5 |