TMEM126B-transmembrane protein 126B Gene View larger

TMEM126B-transmembrane protein 126B Gene

PTXBC017574

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TMEM126B-transmembrane protein 126B Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about TMEM126B-transmembrane protein 126B Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC017574
Product type: DNA & cDNA
Ncbi symbol: TMEM126B
Origin species: Human
Product name: TMEM126B-transmembrane protein 126B Gene
Size: 2ug
Accessions: BC017574
Gene id: 55863
Gene description: transmembrane protein 126B
Synonyms: complex I assembly factor TMEM126B, mitochondrial; HT007; transmembrane protein 126B
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcagcatctatgcatggtcagcccagtccttctctagaagatgcaaaactcagaagaccaatggtcatagaaatcatagaaaaaaattttgactatcttagaaaagaaatgacacaaaatatatatcaaatggcgacatttggaacaacagctggtttctctggaatattctcaaacttcctgttcagacgctgcttcaaggttaaacatgatgctttgaagacatatgcatcattggctacacttccatttttgtctactgttgttactgacaagctttttgtaattgatgctttgtattcaggtgaatttaaattcactaatgtataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - spire homolog 1 (Drosophila)
- LY6/PLAUR domain containing 1
- ISG15 ubiquitin-like modifier
- ADP-ribosylation factor-like 2

Reviews

Buy TMEM126B-transmembrane protein 126B Gene now

Add to cart