Cart 1 Product Products 121,50 € (empty)
-
1 x TUBD1-tubu...121,50 €
No products
To be determined Shipping
121,50 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 1 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 121,50 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 121,50 €
Data sheet of INS-insulin Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about INS-insulin Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC005255 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | INS |
| Origin species: | Human |
| Product name: | INS-insulin Gene |
| Size: | 2ug |
| Accessions: | BC005255 |
| Gene id: | 3630 |
| Gene description: | insulin |
| Synonyms: | IDDM; IDDM1; IDDM2; ILPR; IRDN; MODY10; preproinsulin; proinsulin |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggccctgtggatgcgcctcctgcccctgctggcgctgctggccctctggggacctgacccagccgcagcctttgtgaaccaacacctgtgcggctcacacctggtggaagctctctacctagtgtgcggggaacgaggcttcttctacacacccaagacccgccgggaggcagaggacctgcaggtggggcaggtggagctgggcgggggccctggtgcaggcagcctgcagcccttggccctggaggggtccctgcagaagcgtggcattgtggaacaatgctgtaccagcatctgctccctctaccagctggagaactactgcaactag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - apelin - maestro - coilin - latexin |