Cart 33 Product Products 3 944,54 € (empty)
-
-
1 x DYNC2LI1-d...113,40 € -
1 x C13orf39-c...113,40 € -
1 x C18orf55-c...113,40 € -
1 x MBIP-MAP3K...121,50 € -
1 x DEFB127-de...113,40 € -
-
-
1 x BZW2-basic...121,50 € -
1 x BCL2A1-BCL...113,40 € -
1 x BNIP2-BCL2...121,50 € -
1 x ASPHD2-asp...121,50 € -
1 x C17orf91-c...113,40 € -
1 x C11orf87-c...113,40 € -
1 x TAZ-tafazz...113,40 € -
1 x C17orf75-c...121,50 € -
1 x C10orf84-c...113,40 € -
-
1 x FGF19-fibr...113,40 € -
1 x C9orf24-ch...113,40 € -
1 x MAP6-micro...121,50 € -
1 x MARCKS...259,07 € -
-
1 x LBP-lipopo...121,50 € -
-
-
1 x TRIAP1-TP5...113,40 € -
1 x SNX32-sort...121,50 € -
-
1 x Mini...174,00 € -
1 x RHOA-ras...113,40 € -
1 x C1orf64-ch...113,40 € -
1 x C12orf64-c...113,40 €
No products
To be determined Shipping
3 944,54 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 33 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 3 944,54 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 3 944,54 €
Data sheet of CISD1-CDGSH iron sulfur domain 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about CISD1-CDGSH iron sulfur domain 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC005962 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | CISD1 |
| Origin species: | Human |
| Product name: | CISD1-CDGSH iron sulfur domain 1 Gene |
| Size: | 2ug |
| Accessions: | BC005962 |
| Gene id: | 55847 |
| Gene description: | CDGSH iron sulfur domain 1 |
| Synonyms: | C10orf70; MDS029; ZCD1; mitoNEET; CDGSH iron-sulfur domain-containing protein 1; zinc finger CDGSH-type domain 1; CDGSH iron sulfur domain 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgagtctgacttccagttccagcgtacgagttgaatggatcgcagcagttaccattgctgctgggacagctgcaattggttatctagcttacaaaagattttatgttaaagatcatcgaaataaagctatgataaaccttcacatccagaaagacaaccccaagatagtacatgcttttgacatggaggatttgggagataaagctgtgtactgccgttgttggaggtccaaaaagttcccattctgtgatggggctcacacaaaacataacgaagagactggagacaatgtgggccctctgatcatcaagaaaaaagaaacttaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - myocyte enhancer factor 2B - matrix metallopeptidase 28 - histone acetyltransferase 1 - DEP domain containing 1B |