Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of MRP63-mitochondrial ribosomal protein 63 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about MRP63-mitochondrial ribosomal protein 63 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC000002 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | MRP63 |
| Origin species: | Human |
| Product name: | MRP63-mitochondrial ribosomal protein 63 Gene |
| Size: | 2ug |
| Accessions: | BC000002 |
| Gene id: | 78988 |
| Gene description: | mitochondrial ribosomal protein 63 |
| Synonyms: | MRP63; bMRP63; ribosomal protein 63, mitochondrial; hMRP63; mitochondrial ribosomal protein 63; mitochondrial ribosomal protein bMRP63; mitochondrial ribosomal protein L57 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgttcctgactgcgctcctctggcgcggccgcattcccggccgtcagtggatcgggaagcaccggcggccgcggttcgtgtcgttgcgcgccaagcagaacatgatccgccgcctggagatcgaggcggagaaccattactggctgagcatgccctacatgacccgggagcaggagcgcggccacgccgcggtgcgcaggagggaggccttcgaggccataaaggcggccgccacttccaagttccccccgcatagattcattgcggaccagctcgaccatctcaatgtcaccaagaaatggtcctaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - S100 calcium binding protein A11 - chromosome 8 open reading frame 4 - chemokine (C-X-C motif) ligand 13 - mitochondrial ribosomal protein S6 |