Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of EPAS1-endothelial PAS domain protein 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about EPAS1-endothelial PAS domain protein 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC015869 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | EPAS1 |
| Origin species: | Human |
| Product name: | EPAS1-endothelial PAS domain protein 1 Gene |
| Size: | 2ug |
| Accessions: | BC015869 |
| Gene id: | 2034 |
| Gene description: | endothelial PAS domain protein 1 |
| Synonyms: | ECYT4; HIF2A; HLF; MOP2; PASD2; bHLHe73; endothelial PAS domain-containing protein 1; EPAS-1; HIF-1-alpha-like factor; HIF-1alpha-like factor; HIF-2-alpha; HIF2-alpha; PAS domain-containing protein 2; basic-helix-loop-helix-PAS protein MOP2; class E basic helix-loop-helix protein 73; hypoxia-inducible factor 2 alpha; member of PAS protein 2; endothelial PAS domain protein 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggtctttcacacggcacatttggacatttccagaactaccatgagatggtttagacgggaattcatgcaaatgaggggtcaaaaatggtatagtgaccccgtccacgtcctccaagctcacgaccttggagccccgtggagctggactgaggaggaggctgcacagcgggagagcagctggtccagaccagccctgcagcccccactcagccggcagccagatggccccgcaaggcctccagggatggcccctagccacaggccctggctgaggtctctgggtcggtcagtgacatgtaggtag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - chemokine (C-X-C motif) ligand 3 - hypothetical protein MGC16291 - hypothetical protein MGC14425 - methylthioadenosine phosphorylase |