Cart 8 Product Products 1 535,41 € (empty)
-
1 x TPST1-tyro...121,50 € -
1 x PHF5A-PHD...113,40 € -
-
-
1 x Free Estriol399,00 € -
1 x SNRPE-smal...113,40 € -
1 x BUB3-buddi...121,50 € -
1 x ATXN7L3-at...121,50 €
No products
To be determined Shipping
1 535,41 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 8 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 1 535,41 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 1 535,41 €
View larger 
PHLDB1-pleckstrin homology-like domain, family B, member 1 Gene
PTXBC014510
New product
Data sheet of PHLDB1-pleckstrin homology-like domain, family B, member 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about PHLDB1-pleckstrin homology-like domain, family B, member 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC014510 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | PHLDB1 |
| Origin species: | Human |
| Product name: | PHLDB1-pleckstrin homology-like domain, family B, member 1 Gene |
| Size: | 2ug |
| Accessions: | BC014510 |
| Gene id: | 23187 |
| Gene description: | pleckstrin homology-like domain, family B, member 1 |
| Synonyms: | pleckstrin homology-like domain family B member 1; LL5alpha; pleckstrin homology-like domain family B member 1 variant 3; pleckstrin homology-like domain family B member 1 variant 4; protein LL5-alpha; pleckstrin homology like domain family B member 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgggcggcaagattaaatcatggaagaagcgctggtttgtcttcgaccggctcaagcgcaccctttcctattatgtggacaagcatgagacgaagctgaagggagtcatctatttccaggccattgaggaagtgtactacgaccacctgcgcagtgcagccaagagcccgaacccagccctcaccttctgcgtaaagacccatgaccggctgtactacatggtggccccatctgcagaggccatgcgtatctggatggatgtcattgtcacaggggctgagggctacactcagttcatgaactaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - staufen, RNA binding protein, homolog 2 (Drosophila) - SH3 domain binding glutamic acid-rich protein like - ChaC, cation transport regulator homolog 2 (E. coli) - cytidine monophosphate (UMP-CMP) kinase 1, cytosolic |