Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of DPY30-dpy-30 homolog (C. elegans) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about DPY30-dpy-30 homolog (C. elegans) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC015970 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | DPY30 |
| Origin species: | Human |
| Product name: | DPY30-dpy-30 homolog (C. elegans) Gene |
| Size: | 2ug |
| Accessions: | BC015970 |
| Gene id: | 84661 |
| Gene description: | dpy-30 homolog (C. elegans) |
| Synonyms: | Cps25; HDPY-30; Saf19; protein dpy-30 homolog; dpy-30 homolog; dpy-30-like protein; dpy-30L; dpy-30, histone methyltransferase complex regulatory subunit |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggagccagagcagatgctggagggacaaacgcaggttgcagaaaatcctcactctgagtacggtctcacagacaacgttgagagaatagtagaaaatgagaagattaatgcagaaaagtcatcaaagcagaaggtagatctccagtctttgccaactcgtgcctacctggatcagacagttgtgcctatcttattacagggacttgctgtgcttgcaaaggaaagaccaccaaatcccattgaatttctagcatcttatcttttaaaaaacaaggcacagtttgaagatcgaaactga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - transmembrane protein 100 - transmembrane protein 203 - enabled homolog (Drosophila) - translocator protein (18kDa) |